View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13024_high_15 (Length: 235)
Name: NF13024_high_15
Description: NF13024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13024_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 20 - 221
Target Start/End: Original strand, 11173013 - 11173213
Alignment:
| Q |
20 |
aacattataccctccaataaacaaatttaactgaaaaatccgactcaaccgaataacttattaacttatgagtccatattcaccaatgatgagaaacaaa |
119 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||||||||||| |
|
|
| T |
11173013 |
aacattataccccccaataaacaaatttaactgaaaaatccgactcaaccgaataacttattagcatatgaatccatattcaccaatgatgagaaacaaa |
11173112 |
T |
 |
| Q |
120 |
gttttctatatgacacatacaattcaaatatgaagattccaattaacttcagcatagcacaaaggctttcactgaaggtattgttctcgaagtctatctc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11173113 |
gttttctatatgacacatacaattcaaatatgaagattccaattaacttcagcatagcacaaaggc-ttcactgaaggtattgttctcgaagtctatctc |
11173211 |
T |
 |
| Q |
220 |
tg |
221 |
Q |
| |
|
|| |
|
|
| T |
11173212 |
tg |
11173213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University