View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13024_high_8 (Length: 356)
Name: NF13024_high_8
Description: NF13024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13024_high_8 |
 | |
|
| [»] scaffold0439 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 20039817 - 20040045
Alignment:
| Q |
1 |
ctttacctgtgtttgtagcaaggtactgcttacgtctcagtgctcgtcccgaagaccaacactgacgcattactcttcttcgaaaagatggggtatgaga |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20039817 |
ctttacctgtgtttgtagcaaggtgctgcttacatctcagtgctcgtcccgaagaccaacactgacgcattactcttcttcgaaaagatggggtatgaga |
20039916 |
T |
|
| Q |
101 |
aggaggtggtgaagggcaatattaatattaatgggaatgatgattctaatgtcatcatgatgaagaaactcaaggggaagcagatgcattctgcggagac |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
20039917 |
aggaggtggtgaagggcaa---taatattaatgggaatgatgatgctaatgtcatcatgatgaagaagctcaaggggaagcagatgcattctgcggagac |
20040013 |
T |
|
| Q |
201 |
cgaaggtaatccaaaaggcacttgattgttag |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
20040014 |
cgaaggtaatccaaaaggcacttgattgttag |
20040045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 228 - 267
Target Start/End: Original strand, 20040242 - 20040280
Alignment:
| Q |
228 |
gttagtaagtgtgtgattctattcatgatattaaagtttg |
267 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
20040242 |
gttagtaagtgtgtgattctattc-tgatattaaagtttg |
20040280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0439 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: scaffold0439
Description:
Target: scaffold0439; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 7 - 106
Target Start/End: Complemental strand, 5034 - 4935
Alignment:
| Q |
7 |
ctgtgtttgtagcaaggtactgcttacgtctcagtgctcgtcccgaagaccaacactgacgcattactcttcttcgaaaagatggggtatgagaaggagg |
106 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||| || ||| |||| || ||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
5034 |
ctgtgtttgtagcaaggtgctgcttacgtctcagtgtccgtccagacgacagacaccgaagcattactcttcttcaaaaagatggggtatgagcaggagg |
4935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University