View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13024_low_12 (Length: 258)
Name: NF13024_low_12
Description: NF13024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13024_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 46355720 - 46355616
Alignment:
| Q |
1 |
ccagtttgttcttcgaaggatgtttttggagatccggtttcaaaacatatacgttgggtaaccgcaaaagtgagtcatataataaccatgtaacaccatg |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46355720 |
ccagtttgttcttcaaaggatgtttttggagatccggtttcaaaacatatacgttgggtaaccgcaaaagtgagtcatataataaccatgtaacaccatg |
46355621 |
T |
 |
| Q |
101 |
tataa |
105 |
Q |
| |
|
||||| |
|
|
| T |
46355620 |
tataa |
46355616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 218 - 246
Target Start/End: Complemental strand, 46355501 - 46355473
Alignment:
| Q |
218 |
gattgggtgtggttccaactatttatatt |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46355501 |
gattgggtgtggttccaactatttatatt |
46355473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University