View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13024_low_16 (Length: 220)
Name: NF13024_low_16
Description: NF13024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13024_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 172
Target Start/End: Complemental strand, 38276588 - 38276416
Alignment:
| Q |
1 |
ctactttggaaatatggtgaaacacatgatagcaacctttcatttcccatgaagctttcttacctatgcattcctcagagccctaactatgaatgatgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38276588 |
ctactttggaaatatggtgaaacacatgatagcaacctttcatttcccatgaagctttctgacctatgcattcctcagagccctaactatgaatgatgtt |
38276489 |
T |
 |
| Q |
101 |
attgcttatagaacatagcaaagatgaatatggaaaac-aatacaaaaaacatgtctcaatagtggaagaatt |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
38276488 |
attgcttatagaacatagcaaagatgaatatggaaaacaaatacaaaaaacatgtctcaaaggtggaagaatt |
38276416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 5 - 54
Target Start/End: Complemental strand, 38277792 - 38277743
Alignment:
| Q |
5 |
tttggaaatatggtgaaacacatgatagcaacctttcatttcccatgaag |
54 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38277792 |
tttggaaatatggtgaaacacatgatggcaacctttcatttcccatgaag |
38277743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 2 - 74
Target Start/End: Complemental strand, 26572373 - 26572301
Alignment:
| Q |
2 |
tactttggaaatatggtgaaacacatgatagcaacctttcatttcccatgaagctttcttacctatgcattcc |
74 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26572373 |
tactttggaaatataatgaaacacatgatagcaatctttcatttcccatgaagctttgagacctatgcattcc |
26572301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University