View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13025_high_3 (Length: 202)
Name: NF13025_high_3
Description: NF13025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13025_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 12 - 121
Target Start/End: Complemental strand, 40406615 - 40406510
Alignment:
| Q |
12 |
catcatcatgttggctgtattcatgagagttgaaaagggccaccaccaccacccttgaacaa-ccttcttcaatacttacttattccttcactctcactt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
40406615 |
catcatcatgttggctgtattcatgagagttgaaaagggccaccaccaccacc-----acaacccttgaacaatacttacttattccttcactctcactt |
40406521 |
T |
|
| Q |
111 |
tcactcattca |
121 |
Q |
| |
|
||||||||||| |
|
|
| T |
40406520 |
tcactcattca |
40406510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 14 - 58
Target Start/End: Complemental strand, 40387398 - 40387354
Alignment:
| Q |
14 |
tcatcatgttggctgtattcatgagagttgaaaagggccaccacc |
58 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40387398 |
tcatcatgctggctgtattcatgagagttgaaaagggccaccacc |
40387354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University