View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13025_low_3 (Length: 292)
Name: NF13025_low_3
Description: NF13025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13025_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 285
Target Start/End: Complemental strand, 51264590 - 51264319
Alignment:
| Q |
18 |
atgatctagctgaaactcattggtgaagcaatgtatatttgtctggcaaacaatctactcaccaacgagagtgctttttcagaatctataaatagagggc |
117 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51264590 |
atgatctagctgaaactcattggtgaaacaatgtatatttatctggcaaacaatctactcaccaacgagagtgctttttcagaatctataaatagagggc |
51264491 |
T |
|
| Q |
118 |
ttgtaacatcattttattctcatttttatcttgtcaaattt----nnnnnnnnnnnnnnnggcagaaacaaggtggaaacatcaaaggcttgtagatcaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51264490 |
ttgtaacatcattttattctcatttttatcttgtcaaattttagagagagagagagagagggcagaaacaaggtggaaacatcaaaggcttgtagatcaa |
51264391 |
T |
|
| Q |
214 |
gatcatctagaggaaaagtccttagtggagtcgtcacctagttcatccggatatgagtgcaaccttcttctc |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51264390 |
gatcatctagaggaaaagtccttagtggagtcgtcacctagttcatccggatatgagtgcaaccttcttctc |
51264319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University