View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13026_low_6 (Length: 233)
Name: NF13026_low_6
Description: NF13026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13026_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 13 - 217
Target Start/End: Complemental strand, 36543039 - 36542835
Alignment:
| Q |
13 |
aagaatatcaagcattgtgaaaagccaaatatcacaaaaacaccatatacttagaaaactttcagtcactaaataatattattctcattcaaatggacaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| | || |
|
|
| T |
36543039 |
aagaatatcaagcattgtgaaaagccaaatatcacaaaaacaccatatacttagaaaactttcagacaataaataatattattctcattcaaatgtaaaa |
36542940 |
T |
|
| Q |
113 |
ctctaatgccccaaccaacccgattgctttatagattttaaagtggagaatttgattaaggtgaaagcggtgggggcaaaattggtctatgagaagatga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36542939 |
ctctaatgccccaaccaacccgattgctttatagattttaaagtggagaatttgattaaggtgaaagcggtgggggcaaaattggtctatgagaagatga |
36542840 |
T |
|
| Q |
213 |
tgttg |
217 |
Q |
| |
|
||||| |
|
|
| T |
36542839 |
tgttg |
36542835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University