View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13027_high_16 (Length: 225)
Name: NF13027_high_16
Description: NF13027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13027_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 16 - 203
Target Start/End: Original strand, 13231340 - 13231527
Alignment:
| Q |
16 |
aagaatatgaaaacacaaggtcttgaacttgaaacagtgattgacataaagcataaacctgttagtttcactggaggacttgaatttgaatctcttacat |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13231340 |
aagaaaatgaaaacacaaggtcttgaacttgaaacagtgattgacataaagcataaacctgttagtttcactggaggacttgaatttgaatctcttacat |
13231439 |
T |
 |
| Q |
116 |
acacagtgacaaagaagaagaaagttgatggaaaatggtcaaatgaagatgttgatttgttgcatgatataacaggttatgcaccaaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13231440 |
acacagtgacaaagaagaagaaagttgatggaaaatggtcgaatgaagatgtggatttgttgcatgatataacaggttatgcaccaaa |
13231527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University