View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13027_low_13 (Length: 248)
Name: NF13027_low_13
Description: NF13027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13027_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 15 - 228
Target Start/End: Original strand, 7624314 - 7624527
Alignment:
| Q |
15 |
cagagaccaaaaatgacggtttatgatattgtacgggtaaaaataatacagggactaaaatcaaagtttgctatatttgtagaagaacctcttcaacaag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7624314 |
cagagaccaaaaatgacggtttatgatattgtacgggtaaaaataatacagggactaaaatcaaagtttgctatatttgtagaagaacctcttcaacaag |
7624413 |
T |
 |
| Q |
115 |
caatagatataaaattcatactgaagcagacagtatataacaatgctcacctgccatccaaaagggtagacaaactgatatccatctttcctatccacaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7624414 |
caatagatataaaattcatactgaagcagacagtatataacaatgctcacctgccatccaaaagggtagacaaactgatatccatctttcctatccacaa |
7624513 |
T |
 |
| Q |
215 |
ctggctgaaatcct |
228 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7624514 |
ctggctgaaatcct |
7624527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University