View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13027_low_14 (Length: 240)
Name: NF13027_low_14
Description: NF13027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13027_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 27984900 - 27985119
Alignment:
| Q |
1 |
acactattctcagttgaatgaatggggaaagaagtgtaaggaatgaaatcctcaaatattatagggtgatcttgttcgtaccacatgcacaactttgtat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27984900 |
acactattctcagttgaatgaatggggaaagaagtgtaaggaatgaaatcctcaaatattatagggtgatattgttcgtaccacatgcacaactttgtat |
27984999 |
T |
 |
| Q |
101 |
ttatgaagtgttaataatttcaaatttatatagatcccaacttttaggctaaattgcattgcaattaaataatgtggaacaaaaaacttaatttttacaa |
200 |
Q |
| |
|
| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27985000 |
taatgaagtgttaataatttcaaatt--tatagatcccaacttttaggctaaattgcattgcaattaaataatgtggaacaaaaaacttaatttttacaa |
27985097 |
T |
 |
| Q |
201 |
gtcttgttgatttgggactacc |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
27985098 |
gtcttgttgatttgggactacc |
27985119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University