View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13027_low_16 (Length: 225)

Name: NF13027_low_16
Description: NF13027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13027_low_16
NF13027_low_16
[»] chr5 (1 HSPs)
chr5 (16-203)||(13231340-13231527)


Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 16 - 203
Target Start/End: Original strand, 13231340 - 13231527
Alignment:
16 aagaatatgaaaacacaaggtcttgaacttgaaacagtgattgacataaagcataaacctgttagtttcactggaggacttgaatttgaatctcttacat 115  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13231340 aagaaaatgaaaacacaaggtcttgaacttgaaacagtgattgacataaagcataaacctgttagtttcactggaggacttgaatttgaatctcttacat 13231439  T
116 acacagtgacaaagaagaagaaagttgatggaaaatggtcaaatgaagatgttgatttgttgcatgatataacaggttatgcaccaaa 203  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||    
13231440 acacagtgacaaagaagaagaaagttgatggaaaatggtcgaatgaagatgtggatttgttgcatgatataacaggttatgcaccaaa 13231527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University