View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13027_low_6 (Length: 405)
Name: NF13027_low_6
Description: NF13027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13027_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 366; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 18 - 395
Target Start/End: Complemental strand, 52272579 - 52272202
Alignment:
| Q |
18 |
attacatgggagatgttggttttcatcatgttaatattgctatctaaatcattgcttatgatgagtttcaggatgtggtttcagaaactatacatgcatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52272579 |
attacatgggagatgttggttttcatcatgttaatattgctatctaaatcattgcttatgatgagtttcaggatgtggtttcagaaactatacatgcatt |
52272480 |
T |
 |
| Q |
118 |
tcgagctcccgttgatgatacccaggtattctgtcacccatttattcagctgctttcttaaaaatgtagattttgttcatcaagtgcttatttgtctttg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52272479 |
tcgagctcccgttgatgatacccaggtattctgtcacccatttattcagacgctttcttaaaaatgtagattttgttcaccaagtgcttatttgtctttg |
52272380 |
T |
 |
| Q |
218 |
atttctaggatctcttttctgattctgaaataaatgatattaaagaagaggccctaaatgggaagttgaataagccttccgaagaagtgtttgccccatc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52272379 |
atttctaggatctcttttctgattctgaaataaatgatattaaagaagaggccctaaatgggaagttgaataagccttccgaagaagtgtttgccccatc |
52272280 |
T |
 |
| Q |
318 |
tatgctttcaatgaacttgaaacttgattctgctcctgttgatgatgatatgtaagtttttagatgtttcttcctttg |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52272279 |
tatgctttcaatgaacttgaaacttgattctgctcctgttgatgatgatatgtaagtttttagatgtttcttcctttg |
52272202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University