View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13027_low_8 (Length: 366)
Name: NF13027_low_8
Description: NF13027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13027_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 4958280 - 4958541
Alignment:
| Q |
1 |
gtgaggatccataaacttcatgtcttaagattttgggtaaaggtgtgactccaactcacttgtgtgattgctcttacctaacgtgaacgattccctgact |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4958280 |
gtgaggacccataaacttcatgtcttaagattttgggtaaaggtgtgacttcaactcacttgtgtgattgctcttacctaacgtgaacgattccctgact |
4958379 |
T |
 |
| Q |
101 |
tttcttgtgacctaaccgttgtatcagagttgaaggttcgaccgactccttgtatcgaaaattttaatgatccaatatagaatatagatgattgatcccc |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
4958380 |
tttctcgtgacctaaccgttgtatcagagttgaaggttcgaccgactccttgtatcgaaaatcttcatgatccaatatagaatatagatgattgatcccc |
4958479 |
T |
 |
| Q |
201 |
tcatgacccaacaaaattttacaaaactgcatagtgtgataaattattatataataaaatct |
262 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4958480 |
tcatgacccaataaaattttacaaaactgcatagtgtgataaactattatataataaaatct |
4958541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University