View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13029_high_11 (Length: 317)
Name: NF13029_high_11
Description: NF13029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13029_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 4 - 296
Target Start/End: Complemental strand, 6357619 - 6357343
Alignment:
| Q |
4 |
gatggacatcatcagtttgatttttatgacagtatgagttttttcaatattttacatacaaagattcaagtgttgttaatatgaatcactctcggatttt |
103 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6357619 |
gatggacattttcagtttgatttttatgatagtatgagttttttcaatattttacatacaaagattcaagtgttgttaatatgaatcactctcggatttt |
6357520 |
T |
 |
| Q |
104 |
tctaacaccttccatgtcgtacaattagtggcgaaggaaactctgaggtttcatcaatatggtaacctcttgaaattaattcaaaagctctttgattgag |
203 |
Q |
| |
|
||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6357519 |
tcttacacctttcatgtcgtacaattagtggcgaaggaaactctgaggtttcatcaatatggtaacctcttgaaattaattcaaaagctctttgattgag |
6357420 |
T |
 |
| Q |
204 |
gattgaaatatctccatcaaacacatcctcggagaaggaaactcttgtgtgggtattcttgccaaagctaatcatacaaaatatcttataatg |
296 |
Q |
| |
|
||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6357419 |
gattgaaatatctccattaaccacat----------------tcttgtgtgggtattcttgccaaagctaatcatacaaaatctcttataatg |
6357343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University