View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13029_low_17 (Length: 243)
Name: NF13029_low_17
Description: NF13029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13029_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 22829087 - 22828860
Alignment:
| Q |
1 |
aagttaaaaatcaacatgcaatcaatgcaaagaactccttataacattgagccttaatgcaaacctaatccttctattttcttccttgtctctatcgagt |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | ||||| |||||| |
|
|
| T |
22829087 |
aagttaaaaatcaacattcaatcaatgcaaagaactccttataacattgagccttaatgcaagcctaatccttctattttcttccctctctctgtcgagt |
22828988 |
T |
 |
| Q |
101 |
gcccaccttcctcccttctttgataatttgaagaattgataagcaagtaccattgcatgtttgataggagtgatgattaagggttaatgggtacttggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
22828987 |
tcccaccttcctcccttctttgataatttgaagaattgaaaagcaactaccattgcatgtttgattagagtgatgattaagggttaatgggtacttgaaa |
22828888 |
T |
 |
| Q |
201 |
tc-agaagagggagattaagcaatgact |
227 |
Q |
| |
|
|| |||||||| |||||||||||||||| |
|
|
| T |
22828887 |
tcaagaagaggaagattaagcaatgact |
22828860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University