View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1302_high_13 (Length: 378)
Name: NF1302_high_13
Description: NF1302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1302_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 13 - 294
Target Start/End: Original strand, 42661606 - 42661889
Alignment:
| Q |
13 |
aaggtgcttgtagtagctgatcattcctatcatctccatagtaggannnnnnn--atcatattgaagttgcttttccttcgttatgattcttttcgtagt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42661606 |
aaggtgcttgtagtagctgatcattcctatcatctccatagtatgatttttttttatcatattgaagttgcttttccttcgttatgattcttttcgtagt |
42661705 |
T |
|
| Q |
111 |
ttttccatgttgaatctgtgtcctttcttctggatcctttatctatactgttgcgcattatttccaacaaaatgctattgtatttcttggcttgggttgc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42661706 |
ttttccatgttgaatctgtgtcctttcttctggatcctttatctatactgttgcgcattatttccaacaaaatggtattgtatttcttggcttgggttgc |
42661805 |
T |
|
| Q |
211 |
tcgattataatggcaactatcaagtacataattttgttgctggggattgtaacaccagatttatgtcaagagagttgttcttgc |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42661806 |
tcgattataatggcaactatcaagtacataattttgttgctggggattgtaacaccagatttatgtcaagagagttgttcttgc |
42661889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University