View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1302_high_23 (Length: 314)
Name: NF1302_high_23
Description: NF1302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1302_high_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 111 - 238
Target Start/End: Complemental strand, 1067829 - 1067702
Alignment:
| Q |
111 |
agaggttagagagagagaaagagtttcatggtgctgtttgtaacagaacagaacagaacaatgagtacctcgtgcgtgtggttttgctttttatatgttt |
210 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1067829 |
agaggttagagaaagagaaagagtttcacggtgctgtttgtaacagaacagaacagaacaatgagtacctcgtgcgtgtggttttgctttttatatgttt |
1067730 |
T |
|
| Q |
211 |
atagcagtgagtgtttttcttgtgagta |
238 |
Q |
| |
|
|||| ||||||||||||||||||||||| |
|
|
| T |
1067729 |
atagtagtgagtgtttttcttgtgagta |
1067702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 1067903 - 1067837
Alignment:
| Q |
1 |
atgaatgaaacgaagagaagtgcggggataatgag-aaagccaacgaggtttgcatccatggagtga |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
1067903 |
atgaatgaaacgaagagaagtgcggggataatgagaaaagccagcgaggtttgcatccatggagtga |
1067837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 245 - 307
Target Start/End: Complemental strand, 26269026 - 26268964
Alignment:
| Q |
245 |
agccacaatactaatcggttgcttccaatccaagaaaacgatgcattactactacctttgctt |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26269026 |
agccacaatactaatcggttgcttccaatccaagaaaacgatgcattactactacctttgctt |
26268964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 248 - 307
Target Start/End: Original strand, 3112072 - 3112131
Alignment:
| Q |
248 |
cacaatactaatcggttgcttccaatccaagaaaacgatgcattactactacctttgctt |
307 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3112072 |
cacaaaactaaccggttgcttccaatccaagaaaacgatgcattactactacctttgctt |
3112131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University