View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1302_high_25 (Length: 305)
Name: NF1302_high_25
Description: NF1302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1302_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 84 - 231
Target Start/End: Complemental strand, 40786313 - 40786166
Alignment:
| Q |
84 |
aaacttagagtgaaacaaattaacgtgatgagtttcaccatatgtaacatgaactttatatgatgataatgagagttgaatataacataacctccaattc |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40786313 |
aaacttagagtgaaacaaattaacgtgatgagtttcaccatatgtaacatgaactttatatgatgataatgagagttgaatataacataacctccaattc |
40786214 |
T |
 |
| Q |
184 |
caaatcaaaatatgtacaatggatcctctcacaacaactagtgttcct |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40786213 |
caaatcaaaatatgtacaatggatcctctcacaacaactagtgttcct |
40786166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University