View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1302_high_36 (Length: 224)
Name: NF1302_high_36
Description: NF1302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1302_high_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 67 - 141
Target Start/End: Original strand, 44396176 - 44396250
Alignment:
| Q |
67 |
gataatactgagttgaggaagcttttgattgagactacaagtaagtcaattattgttattgaagacattgattgt |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44396176 |
gataatactgagttgaggaagcttttgattgagactacaagtaagtcaattattgttattgaagacattgattgt |
44396250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 67 - 141
Target Start/End: Original strand, 6971263 - 6971337
Alignment:
| Q |
67 |
gataatactgagttgaggaagcttttgattgagactacaagtaagtcaattattgttattgaagacattgattgt |
141 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||| || ||||| |||||||| ||||||||| |
|
|
| T |
6971263 |
gataacactgagttgaggaagcttttgattgagacatcaagtaagtctataattgtgattgaagatattgattgt |
6971337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 88 - 141
Target Start/End: Original strand, 2842386 - 2842439
Alignment:
| Q |
88 |
cttttgattgagactacaagtaagtcaattattgttattgaagacattgattgt |
141 |
Q |
| |
|
|||||||||||||| | ||||| || ||||||||||||||||| ||||||||| |
|
|
| T |
2842386 |
cttttgattgagacgtcgagtaaatcgattattgttattgaagatattgattgt |
2842439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University