View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1302_high_37 (Length: 208)

Name: NF1302_high_37
Description: NF1302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1302_high_37
NF1302_high_37
[»] chr7 (1 HSPs)
chr7 (71-192)||(42661768-42661889)


Alignment Details
Target: chr7 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 71 - 192
Target Start/End: Original strand, 42661768 - 42661889
Alignment:
71 tccaataatatgctattgtatttcttggcttgggttgctcgattataatggcaactatcaagtacataattttgttgctggggattgtaacaccagattt 170  Q
    ||||| || ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42661768 tccaacaaaatggtattgtatttcttggcttgggttgctcgattataatggcaactatcaagtacataattttgttgctggggattgtaacaccagattt 42661867  T
171 atgtcaagagagttgttcttgc 192  Q
    ||||||||||||||||||||||    
42661868 atgtcaagagagttgttcttgc 42661889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University