View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1302_high_37 (Length: 208)
Name: NF1302_high_37
Description: NF1302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1302_high_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 71 - 192
Target Start/End: Original strand, 42661768 - 42661889
Alignment:
| Q |
71 |
tccaataatatgctattgtatttcttggcttgggttgctcgattataatggcaactatcaagtacataattttgttgctggggattgtaacaccagattt |
170 |
Q |
| |
|
||||| || ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42661768 |
tccaacaaaatggtattgtatttcttggcttgggttgctcgattataatggcaactatcaagtacataattttgttgctggggattgtaacaccagattt |
42661867 |
T |
 |
| Q |
171 |
atgtcaagagagttgttcttgc |
192 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42661868 |
atgtcaagagagttgttcttgc |
42661889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University