View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1302_low_17 (Length: 355)
Name: NF1302_low_17
Description: NF1302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1302_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 97 - 275
Target Start/End: Complemental strand, 36129477 - 36129298
Alignment:
| Q |
97 |
ggatatatgtagtcacattaagacacttccattttattaaattgatgcatgtatatgcgtgtaactgcccgcgtgtcgcattgttgcattgcttcatcaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
36129477 |
ggatatatgtagtcacattaagacacttccattttattaaattgatgcatgtatatgcgtgtaactgcccgcgtgtcgcattgtgtcattgcctcatcaa |
36129378 |
T |
|
| Q |
197 |
ttatgatttagatatcaactaatattaaaacaagggtccaaattcatttatcttatatcat-tatgtatcgtctgtggtg |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| ||||| |
|
|
| T |
36129377 |
ttatgatttagatatcaactaatattaaaacaagggtccaaattcatttatcttatatcatatatgtatagtctatggtg |
36129298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University