View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1302_low_19 (Length: 349)
Name: NF1302_low_19
Description: NF1302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1302_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 57; Significance: 9e-24; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 100 - 181
Target Start/End: Original strand, 3703501 - 3703578
Alignment:
| Q |
100 |
actatacgtttgatgtggactatgtcagagctggtgagtttcttttttgtgtatgagtgatttgtcaaaacttctgaggaac |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||| |||| |||||||||||||||||||||||| |
|
|
| T |
3703501 |
actatacgtttgatgtggactatgtcagagctggtgagtttc----ttgtgtttgagagatttgtcaaaacttctgaggaac |
3703578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 226 - 271
Target Start/End: Original strand, 3698680 - 3698725
Alignment:
| Q |
226 |
tgccgcagcttccattgcaaggaagatctacttgaggggtggactc |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3698680 |
tgccgcagcttccattgcaaggaagatctacttgaggggtggactc |
3698725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 230 - 271
Target Start/End: Original strand, 3703628 - 3703669
Alignment:
| Q |
230 |
gcagcttccattgcaaggaagatctacttgaggggtggactc |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3703628 |
gcagcttccattgcaaggaagatctacttgaggggtggactc |
3703669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 118 - 177
Target Start/End: Original strand, 3698574 - 3698631
Alignment:
| Q |
118 |
actatgtcagagctggtgagtttcttttttgtgtatgagtgatttgtcaaaacttctgag |
177 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||||||||| |||| |
|
|
| T |
3698574 |
actatgtcagagctggtgagtttc--ttttgtgtttgagtgatttgtcaaaacttttgag |
3698631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University