View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1302_low_23 (Length: 321)
Name: NF1302_low_23
Description: NF1302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1302_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 112 - 313
Target Start/End: Complemental strand, 48250909 - 48250707
Alignment:
| Q |
112 |
cgaggaggaagataaggcaaagcagagcagcgagtaacgttggtggttgtcaatagccgatgaggaactaacactgtgcctgcacttgctgcaaccgcca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48250909 |
cgaggaggaagataaggcaaagcagagcagcgagtaacgttggtggttgtcaatagccgatgaggaactaacactgtgcctgcacttgctgcaaccgcca |
48250810 |
T |
 |
| Q |
212 |
ttgtctctcacttttcttcactgttatcctt-ttttcctatgttaagaattaagattcaatgtttttgtttgtttgaggaaaatagagaaaccaccctat |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
48250809 |
ttgtctctcacttttcttcactgttatcctttttttcctatgttaagaattaagattcaatgtttttgtttgtttgaggaaaatagagaaaccacccttt |
48250710 |
T |
 |
| Q |
311 |
gct |
313 |
Q |
| |
|
||| |
|
|
| T |
48250709 |
gct |
48250707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University