View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1302_low_31 (Length: 269)
Name: NF1302_low_31
Description: NF1302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1302_low_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 10 - 254
Target Start/End: Original strand, 45673469 - 45673714
Alignment:
| Q |
10 |
ccaaagggaaaatgaaacatacaccaacgtatagagataactgacagatagattcccttgccactttattcattccttataattcctactaataattaaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45673469 |
ccaaagggaaaatgaaacatacaccaacgtatagagataactgacagatagattcccttgccactttattcattccttataattcctactaataattaaa |
45673568 |
T |
 |
| Q |
110 |
tcacctttcctgcaatccaatccttcttaaactttgatttatgcccaaattaacctttataaaatcatttaggatgaatattgtctcccatttataatt- |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45673569 |
tcacctttcctgcaatccaatccttcttaaagtttgatttatgcccaaattaacctttataaaatcatttaggatgaatattgtctcccatttataatta |
45673668 |
T |
 |
| Q |
209 |
tttaaatgtgtttggattggatgtgagattcttaaatattagacat |
254 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45673669 |
taaaaatgtgtttggattggatgtgagattcttaaatattagacat |
45673714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University