View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1302_low_33 (Length: 267)
Name: NF1302_low_33
Description: NF1302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1302_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 6e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 1 - 169
Target Start/End: Complemental strand, 6998253 - 6998085
Alignment:
| Q |
1 |
atttattatttgaaagactaaaagttacaatattatgtatagtcaacaatttcttttaggtctactaaaaaatatatttttaggttaggtacattttgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6998253 |
atttattatttgaaagactaaaagttacaatattatgtatagtcaacaatttcttttaggtctactaaaaaatatatttttaggttaggtacattttgga |
6998154 |
T |
 |
| Q |
101 |
cttgtgtgttcacaagattggatgtatagtgtttatacgtaatacacatataaagatatgcatttttaa |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6998153 |
tttgtgtgttcacaagattggatgtatagtgtttatacgcaatacacatataaagatatgcatttttaa |
6998085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 186 - 236
Target Start/End: Complemental strand, 6995138 - 6995088
Alignment:
| Q |
186 |
ccacccaagaatcgaatcatattgcataactcaaaaatttatctctgcagg |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6995138 |
ccacccaagaatcgaatcatattgcataactcaaaaatttatctctgcagg |
6995088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University