View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1302_low_34 (Length: 263)
Name: NF1302_low_34
Description: NF1302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1302_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 20 - 227
Target Start/End: Original strand, 10697674 - 10697881
Alignment:
| Q |
20 |
caaaactttcacatcaaatttcaaccacaattttgatgaaaataacatgtactcgtgaatcactaatcatctacatagcacaactaactataatttttag |
119 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10697674 |
caaaactttcacatcaaacttcaaccacaattttcatgaaaataacatgtactcgtgaatcactaatcatctacatagcacaactaactataatttttag |
10697773 |
T |
|
| Q |
120 |
atgtaaaaatatacattatttttgtgggttgggtttggaggtttagggttcaaattctaacaaagagaaaaaactaacatagcaactaacataataatat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
10697774 |
atgtaaaaatatacattatttttgtgggttgggtttggaggtttaaggttcaaattctaacaaagagaaaaaactaacatagcaactaatatactaatat |
10697873 |
T |
|
| Q |
220 |
ttgtcatt |
227 |
Q |
| |
|
|| ||||| |
|
|
| T |
10697874 |
ttatcatt |
10697881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 183 - 227
Target Start/End: Complemental strand, 13762239 - 13762195
Alignment:
| Q |
183 |
agagaaaaaactaacatagcaactaacataataatatttgtcatt |
227 |
Q |
| |
|
|||||||||||||||||| ||| ||||||| |||||||||||||| |
|
|
| T |
13762239 |
agagaaaaaactaacataacaattaacatattaatatttgtcatt |
13762195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University