View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1302_low_40 (Length: 250)
Name: NF1302_low_40
Description: NF1302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1302_low_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 29 - 221
Target Start/End: Complemental strand, 31936012 - 31935820
Alignment:
| Q |
29 |
caccacagacaacattagcagaattcactctaggaaatagttcgccagattactatgacgttagtctcgtagacggttacaatcttccggtgatggttga |
128 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31936012 |
caccaccggcaacattagcagaattcactctaggaaatagttcgccagattactatgacgttagtctcgtagacggttacaatcttccggtgatggttga |
31935913 |
T |
 |
| Q |
129 |
aactagtggcggttcaggttcatgtcagcccactggatgtggagaggatcttaaccggaggtgtccctcggagctgagtgtggacggtggtga |
221 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31935912 |
aactagtggcggttcaggttcatgtcaggccactggatgtggagaggatcttaaccggaggtgtccctcggagctgagagtggacggtggtga |
31935820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 129
Target Start/End: Complemental strand, 27975686 - 27975632
Alignment:
| Q |
75 |
agattactatgacgttagtctcgtagacggttacaatcttccggtgatggttgaa |
129 |
Q |
| |
|
||||| ||| ||||| |||||||| |||||||||||||||||| |||| |||||| |
|
|
| T |
27975686 |
agatttctacgacgtgagtctcgtcgacggttacaatcttccgatgatagttgaa |
27975632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University