View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13030_high_12 (Length: 249)
Name: NF13030_high_12
Description: NF13030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13030_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 11 - 236
Target Start/End: Complemental strand, 24316105 - 24315880
Alignment:
| Q |
11 |
atcatcactaaacacccgtatggattggagagagacaccgagagctcatatttggaaggtggtgcttcctggtttcacaaacgaagatgtgttgattgag |
110 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24316105 |
atcatccctaaacacccgtatggattggagagagacaccgagagctcatatttggaaggtggtgcttcctggtttcacaaacgaagatgtgtttgttgag |
24316006 |
T |
 |
| Q |
111 |
cttcaagatgagagaatgcttcaggttagtgttgagagtggtaatttcatgagtaggtttaagattcctgatgatggtaaccttcaagagcttaaagcga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24316005 |
cttcaagatgagagaatgcttcaggttagtgttgagagtggtaatttcatgagtaggtttaagattcctgatgatggtaaccttcaagagcttaaagcga |
24315906 |
T |
 |
| Q |
211 |
atatggttaatggtgttcttgttgtc |
236 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
24315905 |
atatggttaatggtgttcttgttgtc |
24315880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University