View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13030_low_10 (Length: 323)
Name: NF13030_low_10
Description: NF13030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13030_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 15 - 262
Target Start/End: Complemental strand, 42980967 - 42980720
Alignment:
| Q |
15 |
ctgagtagtgatatgggttcttctccaaattcaaagcctaaaattgttagaggctccgctggttatatcctcgaagatgttcctcatttaatcgattaca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42980967 |
ctgagtagtgatatgggttcttctccaaattcaaagcctaaaattgttagaggctccgctggttatatcctcgaagatgttcctcatttaaccgattaca |
42980868 |
T |
|
| Q |
115 |
ttcccgaattaccagtacgtcgtcgttctctttatgcttttctattacgccctgttaaaacctgtttcttctcttcatagcttagcttatgtatcattca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42980867 |
ttcccgaattaccagtacgtcgtcgttctctttatgcttttctattacgccctgttaaaacctgtttcttctcttcatagcttagcttatgtatcattca |
42980768 |
T |
|
| Q |
215 |
ttctatgtattgaattaaactttcatgaagaaatgaaatatttgtatt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42980767 |
ttctatgtattgaattaaactttcatgaagaaattaaatatttgtatt |
42980720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University