View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13031_low_3 (Length: 243)
Name: NF13031_low_3
Description: NF13031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13031_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 22 - 203
Target Start/End: Complemental strand, 18698636 - 18698447
Alignment:
| Q |
22 |
aaatgtgtttggaaacactcaaattttatgttcttcggaaatcttttgataagtttatcggtaaaaattattcaaatttttaagagtttcgga------a |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
18698636 |
aaatgtgtttggaaacactcaaattttatgttcttcggaaatcttttgataagtttatcggtaaaaattattcaaatttttaagagtttcagattttttt |
18698537 |
T |
 |
| Q |
116 |
ataannnnnnnnnatagaaattgtttggcaataattaaactgatcaaagtggactcatc--gtatatattccacgtcaactagaagttct |
203 |
Q |
| |
|
| |||| ||||||||| ||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18698536 |
tttttatttttttttagagattgtttggaaataattaaactgatgaaagtggactcatcgtgtatatattccacgtcaactagaagttct |
18698447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University