View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13032_high_13 (Length: 299)
Name: NF13032_high_13
Description: NF13032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13032_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 107 - 294
Target Start/End: Original strand, 52273355 - 52273542
Alignment:
| Q |
107 |
ccgcgaagaagtctctgagactcagctcgaagctgtttgagattttcccttctttcctgttaaatcggtgaatctacaaattaataaaatcaataacaaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52273355 |
ccgcgaagaagtctctgagactcagctcgaagctgtttgagattttcccttctttcctgttaaatcggtgaatctacaaattaataaaatcaataacaaa |
52273454 |
T |
 |
| Q |
207 |
ttgtataaaaagaattcactggaaaacgcatacaaaccttctcggcttttcttttattggagatagattctttaagcttcttctcact |
294 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52273455 |
ttgtataaaaataattcactggaaaacgcatacaaaccttctcggcttttcttttattggagatagattctttaagcttcttctcact |
52273542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 19 - 49
Target Start/End: Original strand, 52273274 - 52273304
Alignment:
| Q |
19 |
acaaaacacattaaactatgtgagttattgg |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
52273274 |
acaaaacacattaaactatgtgagttattgg |
52273304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University