View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13032_high_6 (Length: 400)
Name: NF13032_high_6
Description: NF13032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13032_high_6 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 388; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 388; E-Value: 0
Query Start/End: Original strand, 1 - 400
Target Start/End: Original strand, 52273603 - 52274002
Alignment:
| Q |
1 |
tgaaatttcttctttcttctctgaaacttcttctacactaggttgcttaatttctaattcgactgtattcttatccccggattcttctattgtcttctct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52273603 |
tgaaatttcttctttcttctctgaaacttcttctacactaggttgcttaatttctaattcgactgtattcttatccccggattcttctattgtcttctct |
52273702 |
T |
 |
| Q |
101 |
ggaaccctggcgtcaagttcatcgtccatagattcaaactccaaaaccctcttcgcacccaaatcgttttcctcaactgtgtcagtaacattttcaccac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52273703 |
ggaaccctggcgtcaagttcatcgtccatagattcaaactccaaaaccctcttcgcacccaaatcgttttcctcaactgtgtcagtaacattttcaccac |
52273802 |
T |
 |
| Q |
201 |
ccaagctttcaacttcagggacagatcctgtaattgacacctccaagacagaattctgttcggatccagagaatttgattggggacgaaaagggaagagg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52273803 |
ccaagctttcaacttcagggacagatcctctaattgacacctccaagccagaattctgttcggatccagagaatttgattggggacgaaaaggggagagg |
52273902 |
T |
 |
| Q |
301 |
attttctgaaaccctagatgccttcttcaaacgcttaagctttcgttcgatgacgggagaagaaggtaaggcttcgaaatcttcgtcgctatccatgttt |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52273903 |
attttctgaaaccctagatgccttcttcaaacgcttaagctttcgttcgatgacgggagaagaaggtaaggcttcgaaatcttcgtcgctatccatgttt |
52274002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University