View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13032_high_7 (Length: 365)
Name: NF13032_high_7
Description: NF13032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13032_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 2e-99; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 89 - 339
Target Start/End: Original strand, 35507859 - 35508106
Alignment:
| Q |
89 |
agaacctgtgatgggagaaggccatgacctgccttcgatgcgtttgatgccataaacgagaagagaagcccaaggttggtgcatagtaatacatggattc |
188 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35507859 |
agaacctttgatgggagaaggccatgatctgccttcgatgcgtttgatgccataaacgagaagagaagcccaaggttggtgcatagtaatacatggattc |
35507958 |
T |
 |
| Q |
189 |
cgataatttccagaatttnnnnnnnnnnnnnnnnnnttgttgtatcttctcatcgtgtttctgaatttctgattctgattattctggttataaccaaaca |
288 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35507959 |
cgataatttccagaatttgaagaagaagaagaa---ttgttgtatcttctcatcgtgtttctgaatttctgattctgattattctggttataaccaaaca |
35508055 |
T |
 |
| Q |
289 |
cggcgctattacttccacttccttgctcaccactctaaactaggtattata |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35508056 |
cggcgctattacttccacttccttgctcaccactctaaactaggtattata |
35508106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 23 - 83
Target Start/End: Original strand, 9475517 - 9475577
Alignment:
| Q |
23 |
gatttgattatgcatcttggttcgaatacataatttacttgaactgtagcaagccagtgaa |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9475517 |
gatttgattatgcatcttggttcgaatacataacttacttgaactgtagcaagccagtgaa |
9475577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University