View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13032_low_11 (Length: 323)
Name: NF13032_low_11
Description: NF13032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13032_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 10 - 184
Target Start/End: Original strand, 28239771 - 28239945
Alignment:
| Q |
10 |
cagagaaagtctcgagaaaatagtcggtacagatgattcgaggtttagtggatttgaccttgctactcttatcaggaacaaatatgggaaatcttatgat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28239771 |
cagagaaagtctcgagaaaatagtcggtacagatgattcgagatttagtggatttgaccttgctactcttatcaggaacaaatatgggaaatcttatgat |
28239870 |
T |
 |
| Q |
110 |
gtccagttgattaagaaggttagtttcttacaagaggaattacatgagagataagtgagaaattgatatgcctgc |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28239871 |
gtccagttgattaagaaggttagtttcttacaagtggaattacatgagagataagtgagaaattgatatgcctgc |
28239945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 248 - 308
Target Start/End: Original strand, 28240009 - 28240069
Alignment:
| Q |
248 |
gcacatctaaacgatgtgttaagttttgctttttccttatttttctgttacatgatttatg |
308 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
28240009 |
gcacatctaaacgatgtgttaagtttttctttttccttattttgctgttacatgatttatg |
28240069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University