View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13032_low_21 (Length: 210)
Name: NF13032_low_21
Description: NF13032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13032_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 17 - 197
Target Start/End: Complemental strand, 12327980 - 12327799
Alignment:
| Q |
17 |
aatacttgcattgtcgatggcactcaacaccaacataacgtgtcatatgacctccatattttt-taaagactttcgatacaatgaatcagacaaatttag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12327980 |
aatacttgcattgtcgatggcactcaacaccaacataacgtgtcatatgacctccatattttcataaagactttcgatacaatgaatcagacaaatttag |
12327881 |
T |
 |
| Q |
116 |
tcaaaccatcgactctgatagcactattagttccatcgatcaacaatcttattgtccgacctcattgtaagaaacacaggtt |
197 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12327880 |
tcaaatcaacgactctgatagcactattagttccatcgatcaacaatcttattgtccgacctcgttgtaagaaacacaggtt |
12327799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University