View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13033_high_9 (Length: 326)
Name: NF13033_high_9
Description: NF13033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13033_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 8e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 43512863 - 43512986
Alignment:
| Q |
1 |
catttaacgtcatctgatctcaaattggtagtaactaaaattatttacacgtacaaattcagattcccattaggaacaatttcaagctcaatctcttatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43512863 |
catttaacgtcatctgatctcaaattggtagtaactaaaattatttacatgtacaaattcagatccccattaggaacaatttcaagctcaatctcttatt |
43512962 |
T |
|
| Q |
101 |
cttttatattttttacattagaagt |
125 |
Q |
| |
|
|||||||| |||||||||||||||| |
|
|
| T |
43512963 |
cttttata-tttttacattagaagt |
43512986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 192 - 316
Target Start/End: Original strand, 43513052 - 43513176
Alignment:
| Q |
192 |
gaagctcaagctctatttcaaatctgtttttgccatttacaccctactacggattgagtgccaatctttcatattttcaatcatcatcaactattatcta |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
43513052 |
gaagctcaagctctatttcaaatctgtttttgccatttacaccctactacagattgagtgccaatctttgatatttttcatcatcatcaactattatcta |
43513151 |
T |
|
| Q |
292 |
tttgctatttacacccgactctctg |
316 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43513152 |
tttgctatttacacccgactctctg |
43513176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University