View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13034_high_29 (Length: 203)

Name: NF13034_high_29
Description: NF13034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13034_high_29
NF13034_high_29
[»] chr7 (2 HSPs)
chr7 (17-115)||(7904403-7904503)
chr7 (147-184)||(7904504-7904541)


Alignment Details
Target: chr7 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 17 - 115
Target Start/End: Original strand, 7904403 - 7904503
Alignment:
17 atatgacaatcaatatcaagatgtttcgttcattcatacaacacggggtttgtggc--tatgtaacgcgctctggttgtcacaatatagaatggacaaac 114  Q
    ||||||||||||||||||||||||||||||| |||||| ||||||||||||| |||  |||||||||| |||||||||||||||||||||||||||||||    
7904403 atatgacaatcaatatcaagatgtttcgttcgttcatagaacacggggtttgcggcgatatgtaacgcactctggttgtcacaatatagaatggacaaac 7904502  T
115 g 115  Q
    |    
7904503 g 7904503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 147 - 184
Target Start/End: Original strand, 7904504 - 7904541
Alignment:
147 tatgtgagccattggagtttgcgggtggctgatgctaa 184  Q
    ||||||||||||||||||| |||| |||||||||||||    
7904504 tatgtgagccattggagttcgcggatggctgatgctaa 7904541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University