View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13034_high_29 (Length: 203)
Name: NF13034_high_29
Description: NF13034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13034_high_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 17 - 115
Target Start/End: Original strand, 7904403 - 7904503
Alignment:
| Q |
17 |
atatgacaatcaatatcaagatgtttcgttcattcatacaacacggggtttgtggc--tatgtaacgcgctctggttgtcacaatatagaatggacaaac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||||||||| ||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7904403 |
atatgacaatcaatatcaagatgtttcgttcgttcatagaacacggggtttgcggcgatatgtaacgcactctggttgtcacaatatagaatggacaaac |
7904502 |
T |
 |
| Q |
115 |
g |
115 |
Q |
| |
|
| |
|
|
| T |
7904503 |
g |
7904503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 147 - 184
Target Start/End: Original strand, 7904504 - 7904541
Alignment:
| Q |
147 |
tatgtgagccattggagtttgcgggtggctgatgctaa |
184 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
7904504 |
tatgtgagccattggagttcgcggatggctgatgctaa |
7904541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University