View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13035_high_8 (Length: 329)
Name: NF13035_high_8
Description: NF13035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13035_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 22 - 311
Target Start/End: Complemental strand, 229689 - 229400
Alignment:
| Q |
22 |
agactctagaagtaagagagttgtgaatgttagggcgaatatgaaacacctcacaaagggggaggcccacaccaactattagtccagaacttgatatttt |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
229689 |
agactctagaagtaagagagttgtgaatgttagggcgaatatgaaacacctcacaaagggggaggcccacaccaactatcagtccagaacttgatatttt |
229590 |
T |
 |
| Q |
122 |
ccccatttcctaacaaacatgtggaattctcatgaaatgtggtatattcacttttgacattgctccaaattgaggaagaaacatgatgaacaatatgtct |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
229589 |
ccccatttcctaacaaacatgtggaattctcatgaaatgtggtatattcacttttgacattgctccaaattgaggaagaaacatgatgaacaatatgtct |
229490 |
T |
 |
| Q |
222 |
cctatatctgagaactctattttttaggatgactgcccatatttcatcagaattaagcaaattccaacaaagcttgaggtttgaggcttc |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
229489 |
cctatatctgagaactctattttttaggatgactgcccacatttcatcagaattaagcaaattccaacaaagcttgaggtttgaggcttc |
229400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University