View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13035_low_7 (Length: 358)
Name: NF13035_low_7
Description: NF13035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13035_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 345; Significance: 0; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 1 - 349
Target Start/End: Complemental strand, 34418413 - 34418065
Alignment:
| Q |
1 |
ttttagggatattcggaatggcgggaacttataacttgttgtttatttacacatcagagttgtttcctacggtggtgaggaacgcagcgctagggagtgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34418413 |
ttttagggatattcggaatggcgggaacttataacttgttgtttatttacacatcagagttgtttcctacggtggtgaggaacgcagcgctagggagtgc |
34418314 |
T |
 |
| Q |
101 |
gacgcaagccgcgcaaatgggggcgattttggcgccttttgtggtcgttttaggtagttggttgccgttcggagtatttgcggtatgcggcattttaggt |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34418313 |
gacacaagccgcgcaaatgggggcgattttggcgccttttgtggtcgttttaggtagttggttgccgttcggagtatttgcggtatgcggcattttaggt |
34418214 |
T |
 |
| Q |
201 |
gggatgtttgcattttatctgccggagacactgaatatgcctctttatgatacattcaatggattggaggctggacttgcatgatgctattgctagatag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34418213 |
gggatgtttgcattttatctgccggagacactgaatatgcctctttatgatacattcaatggattggaggctggacttgcatgatgctattgctagatag |
34418114 |
T |
 |
| Q |
301 |
ttgtctgtttttacagttattatgtatacatacatgttctttgatgatg |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34418113 |
ttgtctgtttttacagttattatgtatacatacatgttctttgatgatg |
34418065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 1 - 288
Target Start/End: Complemental strand, 34430662 - 34430375
Alignment:
| Q |
1 |
ttttagggatattcggaatggcgggaacttataacttgttgtttatttacacatcagagttgtttcctacggtggtgaggaacgcagcgctagggagtgc |
100 |
Q |
| |
|
|||| |||||||| |||||||| || |||||||| ||||||| ||||||||| | ||||| |||||||||||||||||||| || |||||||||||| | |
|
|
| T |
34430662 |
ttttggggatatttggaatggctgggacttataatttgttgtatatttacacgacggagttatttcctacggtggtgaggaatgcggcgctagggagtac |
34430563 |
T |
 |
| Q |
101 |
gacgcaagccgcgcaaatgggggcgattttggcgccttttgtggtcgttttaggtagttggttgccgttcggagtatttgcggtatgcggcattttaggt |
200 |
Q |
| |
|
|| ||| || || |||||||||||| | | |||||||||||||||||||||| |||||||||||||||| |||||||||| ||||| | ||||| |
|
|
| T |
34430562 |
gatgcaggcggcaagaatgggggcgatatctgtgccttttgtggtcgttttaggtggttggttgccgttcggggtatttgcggcgtgcggattaataggt |
34430463 |
T |
 |
| Q |
201 |
gggatgtttgcattttatctgccggagacactgaatatgcctctttatgatacattcaatggattggaggctggacttgcatgatgct |
288 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| || |||||| |||||||||||||||||||| |
|
|
| T |
34430462 |
gggatgtttgcgttttatctgccggagacactaaatatgcctctttatgatacatttaagggattgatggctggacttgcatgatgct |
34430375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University