View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13036_high_26 (Length: 237)
Name: NF13036_high_26
Description: NF13036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13036_high_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 46026464 - 46026688
Alignment:
| Q |
1 |
agtatcatccgcctcgcccataaatttattaatgatgtcaatatgttttggtcaaaactataaatttctattaaaatataggcttattcattaataaaca |
100 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46026464 |
agtatcatcagcctcacccataaatttattaatgatgtcaatatgttttggtcaaaactataaatttctattaaaatataggcttattcattaataaaca |
46026563 |
T |
 |
| Q |
101 |
aatttaattgtt----nnnnnnncacatttaacacaataattatgatttaaattttaatagtatatgcaccgacgtaatagaatatctcaatcaacataa |
196 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
46026564 |
catttaattgttaaaaaaaaaaacacatttaacacactaattatgatttaaattttaatagtatatgcattgacgtaatagaatatctcaatcaacataa |
46026663 |
T |
 |
| Q |
197 |
attagtctaattttggtaagcattc |
221 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
46026664 |
attagtctaattttggtaagcattc |
46026688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University