View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13036_high_30 (Length: 216)
Name: NF13036_high_30
Description: NF13036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13036_high_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 1e-98; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 18093846 - 18093641
Alignment:
| Q |
1 |
ataacaagggaactggtggatgtaaacgaaatgtttcttttataactgcttgcatgtatggtaacttagctatgtctgtttcttgtattggaataccttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18093846 |
ataacaagggaactggtggatgtaaacgaaatgtttcttttataactgcttgcatgtatggtaacttagctatgtctgtttcttgtattggaataccttt |
18093747 |
T |
 |
| Q |
101 |
gccaacaacttgttcaagttctttttgtacttttgacatgatttttggattgtgcattaactctgccattgcccattctagtgtgtatgttgttgtctct |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| ||| |
|
|
| T |
18093746 |
gccaacaacttgttcaagttccttttgtacttttaacatgatttctggattgtgcattaactctgccattgcccattctagagtgtatgttgttgtgtct |
18093647 |
T |
 |
| Q |
201 |
gctcct |
206 |
Q |
| |
|
| |||| |
|
|
| T |
18093646 |
gttcct |
18093641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 6 - 206
Target Start/End: Complemental strand, 18103849 - 18103649
Alignment:
| Q |
6 |
aagggaactggtggatgtaaacgaaatgtttcttttataactgcttgcatgtatggtaacttagctatgtctgtttcttgtattggaatacctttgccaa |
105 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18103849 |
aagggaactgatggatgtaaacgaagagtttcttttataactgcttgcatgtatggtaacttagctatgtctgtttcttgtattggaatacctttgccaa |
18103750 |
T |
 |
| Q |
106 |
caacttgttcaagttctttttgtacttttgacatgatttttggattgtgcattaactctgccattgcccattctagtgtgtatgttgttgtctctgctcc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |||| |||| ||| |
|
|
| T |
18103749 |
caacttgttcaagttctttttgtacttttgacatgatttctggattttgcattaactctgccattgcccattctagtgtgtatgttattgtgtctgttcc |
18103650 |
T |
 |
| Q |
206 |
t |
206 |
Q |
| |
|
| |
|
|
| T |
18103649 |
t |
18103649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 130 - 184
Target Start/End: Original strand, 13790029 - 13790083
Alignment:
| Q |
130 |
cttttgacatgatttttggattgtgcattaactctgccattgcccattctagtgt |
184 |
Q |
| |
|
|||||||||| || ||||||||||| | ||| || |||||||||||||||||||| |
|
|
| T |
13790029 |
cttttgacataatatttggattgtggagtaattcagccattgcccattctagtgt |
13790083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University