View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13036_low_30 (Length: 232)
Name: NF13036_low_30
Description: NF13036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13036_low_30 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 10093703 - 10093472
Alignment:
| Q |
1 |
tgttactaaatctctctatgttacaaccaacattaacacttctcttttccctcttattcctatgttgtctttctcttcctatggctgcagaatcagccat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10093703 |
tgttactaaatctctctatgttacaaccaacattaacacttctcttttccctcttattcctatgttgtctttctcttcctatggcttcagaatcagccat |
10093604 |
T |
 |
| Q |
101 |
aggtgtaaactggggcacactatcttcacacagattgaaaccctctacagtggttaatcttttgagagataacaagatctcaaaagtgaaactttttgaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10093603 |
aggtgtaaactggggcacactatcttcacacagattgaaaccctctacagtggttaatcttttgagagataacaagatctcaaaagtcaaactttttgaa |
10093504 |
T |
 |
| Q |
201 |
gctgatcctgctatacttaaagcacttatggg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10093503 |
gctgatcctgctatacttaaagcacttatggg |
10093472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University