View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13036_low_4 (Length: 565)
Name: NF13036_low_4
Description: NF13036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13036_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 5e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 5e-85
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 11136857 - 11136633
Alignment:
| Q |
1 |
atggaaaagaaaccaaaatgatgtcataatgacatcatgtatccactgtagtagtgactatgagtaaatcatatttacccctttaggtaactctccaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11136857 |
atggaaaagaaaccaaaatgatgtcataatgacat---gtatccactgtagtagtgaccatgagtaaatcatatttacccctttaggtaactctccaatt |
11136761 |
T |
|
| Q |
101 |
tcaacggctgagtgtaaaagtggatccattatgc-aacattttgtgtgaagtgcaagtgtgactttggattgtacttttgtatcattgttgttttgttct |
199 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11136760 |
tcaacggttgagtgtaaaagtggatccattatgcaaacatgttgtg-gaagtgcaagtgtgactttggattgtacttttgtatcattg-----ttgttct |
11136667 |
T |
|
| Q |
200 |
attcgtcacgtaacttgtatttggtatagcgttt |
233 |
Q |
| |
|
||| |||| ||| ||||||||||||||||||||| |
|
|
| T |
11136666 |
attggtcatgtatcttgtatttggtatagcgttt |
11136633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University