View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13037_high_49 (Length: 221)
Name: NF13037_high_49
Description: NF13037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13037_high_49 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 19 - 175
Target Start/End: Complemental strand, 32977164 - 32977006
Alignment:
| Q |
19 |
attaagtaatgagaacaccacctgtat--gctccaactgaaagttgttctcaatgtacgtttcaattatttgacttatatgcaggaatggactttctcaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32977164 |
attaagtaatgagaacaccacctgtatttgctccaactgaaagttgttctcaatgtacgtttcaattatttgacttatatgcaggaatggactttctcaa |
32977065 |
T |
 |
| Q |
117 |
agtctttaaggaatttacacaaaaactagcagagcacgaaacatgcgtggcattacttt |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32977064 |
agtctttaaggaatttacacaaaaactagcagagcacgaaacatgcgtggcattacttt |
32977006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University