View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13037_high_7 (Length: 539)
Name: NF13037_high_7
Description: NF13037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13037_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 340; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 25 - 397
Target Start/End: Original strand, 54473077 - 54473451
Alignment:
| Q |
25 |
agacaacatgattttcttttttgaaccagttacacagcttcactctcacctgtgtaagataatttgcttgcataagaggattttgcatctcttgtacgat |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54473077 |
agacaacatgattttcttttttgaaccagttacacagcttcactctcacctgtgtaagataatttgcttgcataagaggattttgcatctcttgtacgat |
54473176 |
T |
 |
| Q |
125 |
gatgatttgcttaatgctgtatggacgccacattatcatgattcatatcagtataaaaaagtttttagggataataaatgtcctgcaattttgttacttt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54473177 |
gatgatttgcttaatgctgtatggacgccacattatcatgattcatatcagtataaaaaagtttttagggataataaatgtcctgcaattttgttacttt |
54473276 |
T |
 |
| Q |
225 |
gagtttgagtacgagagtcaaatcatttgattcttgaatgttatcttatggatgccgacgtatctctgcaaagggtaactgctacatatttgaaa--cta |
322 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
54473277 |
gagtttgagtacgagagtctagtcatttgattcttgaattttatcttatggatgccgatgtatctctgcaaagggtaactgctacatatttgaaactcta |
54473376 |
T |
 |
| Q |
323 |
attcactaggtgtgtgtttggtttttctagaaaccacatcaacaacccatgtttaaaccacaattggttgcttca |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
54473377 |
attcactaggtgtgtgtttggtttttctagaaaccacatcaacaacccatgcttaagccacaattggttgcttca |
54473451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 489 - 530
Target Start/End: Original strand, 54473647 - 54473688
Alignment:
| Q |
489 |
catagtatttccaaaacacctaagctctcgacatcccctttg |
530 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54473647 |
catagtatttccaaaacacctaagctctcgacatcccctttg |
54473688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 402 - 449
Target Start/End: Complemental strand, 43779462 - 43779414
Alignment:
| Q |
402 |
atcacgacaattttttc-ttgggacgcaagaatacttgttccaccgcac |
449 |
Q |
| |
|
||||||||||||||| | |||||||||||||| |||||||||| ||||| |
|
|
| T |
43779462 |
atcacgacaatttttgccttgggacgcaagaaaacttgttccatcgcac |
43779414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University