View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13037_low_37 (Length: 299)
Name: NF13037_low_37
Description: NF13037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13037_low_37 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 45 - 281
Target Start/End: Original strand, 39488736 - 39488959
Alignment:
| Q |
45 |
ttgaagatccagtcattttgtgctttccataacacccacataataatgtaaaaaattaacatcaaccttctttcactcttcttcccaaccgacaacccga |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39488736 |
ttgaagatccagtcattttgtgctttccataacacccacataataatgtaaaaaattaacatcaaccttctttcactcttcttcccaaccgacaacccga |
39488835 |
T |
|
| Q |
145 |
tgaagctagataatgatttgnnnnnnntctggtgtaattggtaaaatcagtctcagccatcaaagtaccacattatttcccccgtgaatttagtgattcc |
244 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39488836 |
tgaagctagataatgatttgaaaaaaatctggtgtaattggtaaaatcagtctcagccatcaaagtaccacatt-------------atttagtgattcc |
39488922 |
T |
|
| Q |
245 |
ttttaagaagcgtgttatgctcttggtttgttaaatg |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39488923 |
ttttaagaagcgtgttatgctcttggtttgttaaatg |
39488959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 39488650 - 39488697
Alignment:
| Q |
1 |
acgactttgccagactagctaaaaaccaatgccatgccatttctttga |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39488650 |
acgactttgccagactagctaaaaaccaatgccatgccatctctttga |
39488697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University