View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13037_low_43 (Length: 247)
Name: NF13037_low_43
Description: NF13037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13037_low_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 45400110 - 45399884
Alignment:
| Q |
1 |
tttattctagcatcatttatgccagactcactttttctttacatatatttattacgtcacgtactattaacttcaatagcttgcttctgcatttctgtta |
100 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45400110 |
tttattctagtatcatttatgtcagactcactttttctttacatatatttatcacgtcacgtactattaacttcaatagctt----ctgcatttctgtta |
45400015 |
T |
|
| Q |
101 |
cggaacccaacatagtgtgcattgttaatactcttaattgtttctagttttcactttaatggaatcagtgctgctgatgaatcattttactgactttcat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45400014 |
cggaacccaacatagtgtgcattgttaatactcttaattgtttctagttttcactttaatggaatcagtgctgctgatgaatcatgttactgactttcat |
45399915 |
T |
|
| Q |
201 |
aatcagtcacagtccacctgcttgttaattt |
231 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |
|
|
| T |
45399914 |
aatcagtcacagtccatctgcttgttaattt |
45399884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University