View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13037_low_48 (Length: 225)
Name: NF13037_low_48
Description: NF13037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13037_low_48 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 18 - 205
Target Start/End: Original strand, 32046372 - 32046561
Alignment:
| Q |
18 |
attgatggaactaccggatgtgtatttatgaggccttagatat--tagggggcttaaaaagaaacattattggttccttctgaacaaatttggtggctgc |
115 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32046372 |
attgatggaactacccaatgtgtatttatgaggccttagatatattagggagcctaaaaagaaacattattggttccttctgaacaaatttggtggctgc |
32046471 |
T |
 |
| Q |
116 |
aattgatgatgagtcttgcgagattcacaagggtgatagactgatggtcatttagtgccaaacaaaccatgggtggttgtacatggtgta |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32046472 |
aattgatgatgagtcttgcgagattcacaagggtgatagactgatggtcatttagtgccaaacaaaccatgggtggttgtacatggtgta |
32046561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University