View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13038_low_16 (Length: 387)
Name: NF13038_low_16
Description: NF13038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13038_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 66 - 369
Target Start/End: Original strand, 4020982 - 4021290
Alignment:
| Q |
66 |
aaacgaacaatattaatatttgtcgtttaaaa-taattatcagacggttcgtatttaaagttcaatatttaggattatgnnnnnnnnn-ttaaaactaaa |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4020982 |
aaacgaacaatattaatatttgtcgtttaaaaataattatcagacggttcatatttaaagttcaatatttaggattatgaagaaaaaaattaaaactaaa |
4021081 |
T |
|
| Q |
164 |
ttttgtggattgaaatcttctaatcacc---aatacactgaatgagtgaaaacaaagatattctaattgtcataatcaatttccatttatatatagatca |
260 |
Q |
| |
|
|||||||||||||| |||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4021082 |
ttttgtggattgaagtcttctgatcaccaccaatacactgaatgagtgaaaacaaagatattctaattgtcataatcaatttccatttatatatagatca |
4021181 |
T |
|
| Q |
261 |
atcaatggtnnnnnnnnnnnggttgaatg--tatatatttaccattattcccttgagattgatgcgttgcttggcttttatgttataggtcataatttcc |
358 |
Q |
| |
|
||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4021182 |
atcaatggtaaaataaaaa--gtagaatgtatatatatttaccattattcccttgagattgatgcgttgcttggcttttatgttataggtcataatttcc |
4021279 |
T |
|
| Q |
359 |
tttgctaattg |
369 |
Q |
| |
|
||||||||||| |
|
|
| T |
4021280 |
tttgctaattg |
4021290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University