View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13038_low_18 (Length: 351)
Name: NF13038_low_18
Description: NF13038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13038_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 68 - 332
Target Start/End: Original strand, 1036809 - 1037073
Alignment:
| Q |
68 |
aaataagcccaataacccaatattattcctatttgcactccacctcttcattaagtgactttctccacgagtggctcttcttaattttccaactgtcgcg |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1036809 |
aaataagcccaataacccaatattattcctatttgcactccacctcttcattaagtgactttctccacgagtggctcttcttaattttccaactgtcgcg |
1036908 |
T |
 |
| Q |
168 |
acacgatctttgtagtatacaatgcgatttaaatagtgatgaaacacttctgaactttcctatatctcgcgaagcgggtgaggcaatggcgaaacacttc |
267 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1036909 |
acacgatctttgtagtatacgatgcgatttaaatagtgatgaaacacttctgaactttcgtatatctcgcgaagcgggtgaggcaatggcgaaacacttc |
1037008 |
T |
 |
| Q |
268 |
taactttccatcagtatcacggtgcgtggctcgttgcaagggacacgagtcaggacgaggctaat |
332 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||| ||| |||||||||||||| ||||||||||||| |
|
|
| T |
1037009 |
taactttccatcggtatcacggtgtgtggctcattggaagggacacgagtcgggacgaggctaat |
1037073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University